Isoflavone-enriched whole soy milk powder stimulates osteoblast differentiation (2024)

Abstract

Functional foods with high nutritive values and potential therapeutic potential is a prerequisite for today’s ailing world. Soybeans exert beneficial effects on human health. It contains plentiful polyunsaturated fatty acids and dietary fibers along with several isoflavonoids having bioactivity for improving health. Recent studies have shown that soybean isoflavones can have a positive effect on bone growth. The current study was designed to observe any impact of isoflavone-enriched soy milk powder (I-WSM) on inducing osteogenic properties at cellular and molecular levels. Precisely, we have evaluated the effect of I-WSM on the bone differentiation process. Our results show that I-WSM has the ability to stimulate osteogenic properties in osteoblasts both at the initial and terminal stages of differentiation. Treatment of I-WSM on osteoblasts demonstrates the inductive effect on the expression of osteogenic transcriptional factors like Runx2 and Osterix. Moreover, I-WSM increased the expression of the extracellular matrix protein osteocalcin, required for the formation of scaffold for bone mineralization. The estrogen signaling pathway was utilized by I-WSM to induce osteogenic activity. Taken together, here we report the cellular and molecular events mediated by I-WSM to exert an osteogenic effect in osteoblasts, which will help to understand its mechanism of action and project it as a remedy for the bone-related disease. Taken together, I-WSM has the ability to exert the osteogenic effect in osteoblasts via the estrogen signaling pathway and thus might be projected as a remedy for a bone-related disease like osteoporosis.

Electronic supplementary material

The online version of this article (10.1007/s13197-020-04572-6) contains supplementary material, which is available to authorized users.

Keywords: Osteoblasts, Alkaline phosphatase activity, Estrogen signaling pathway

Introduction

Functional foods and the physiological role of their bioactive compounds have gained much recognition all across the world in current ages. In the current era, where functional foods are mostly used to recover human health issues, soybean attracts many researchers. Soybeans belong to the genus of Glycine Wild and the family of Fabaceae. Glycine Soja is the conventional wild soybean (Hu et al. 2019; Friedman and Brandon 2001). Soybeans have been shown to exert beneficial effects on human health. It contains a meager amount of sodium, cholesterol and saturated fatty acids, but plentiful of polyunsaturated fatty acids and dietary fiber (both soluble and insoluble fiber) (Jeewanthi et al. 2015; Hu et al. 2019). In Asian countries, soybean is widely used as one of the most common sources of protein in a regular diet for decades. Nowadays, due to its nutritional values, it is gaining recognition in the West, too (Hu et al. 2019). Food made from soybeans is known as soy foods, including miso, drinks, salami, tempeh, cheese, tofu, and vegetarian meat substitutes (Friedman and Brandon 2001).

Soybeans contain diverse nutrients, minerals, carbohydrates, proteins, vitamins, and lipids. Among fruits and vegetables, soybeans abundantly include a bio-active component of phenolic nature and non-steroidal and represent chemical structure similar to 17β-estradiol (Ahn and Park 2017). These bioactive compounds are identified as the phytoestrogens or isoflavones due to estrogenic activity especially in concern with human health and belong to a class of molecules related to flavonoids (Liang et al. 2014; Li and Zhang 2017). Among various kinds of isoflavones, daidzein and genistein (free and conjugated forms) constitute 30% and 60% of the total quantity of isoflavones present in soybeans, respectively (Hu et al. 2019). Apart from daidzein and genistein, another major isoflavone is glycitein in soybeans (Zaheer and Humayoun Akhtar 2017). Other than isoflavones, malonylglucosides (malonyldaidzin malonylglycitin and malonylgenistin), and acetylglucosides (acetyldaidzin acetylglycitin and acetylgenistin) are other biologically active molecules in soybeans that have attracted the interest in functional food development.

Previous studies have demonstrated that isoflavones, even from soybean, not only have nutritive properties but also possess various types of biological activities like anti-oxidant, anti-tumor, immune-modulating effect and bone-protective properties (Xu et al. 2017; Zheng et al. 2016; Sharma and Nam 2019; Nguyen et al. 2016). Isoflavones from soybeans can bind estrogen receptor (ER) α and β and thus have been suggested to act as selective estrogen receptor modulators (Setchell and Cassidy 1999). This property is possessed by them due to structural resemblance to endogenous estrogens and their mechanism of action. The capability to bind to both ERs allows them to be utilized for estrogen therapy to prevent or reduce osteoporosis in menopausal women (Oseni et al. 2008). Soybeans isoflavones are most effective in avoiding and reversing bone loss. Recent documented studies suggest that soybeans isoflavones may enhance longitudinal bone growth. Furthermore, supplementation with a high dose of soybean isoflavone increased bone quality by improving BMD and other structural parameters of bone in growing female rats (Ahn and Park 2017). The physiological effects of soybeans isoflavones such as genistein and daidzein were similar to natural estrogen in sustaining bone mass in ovariectomized rats. These soybean isoflavones at a dose of 40 and 80mg/day can elevate climacteric symptoms (Santos et al. 2014). It has been noted that the effect of soy isoflavones is of less affinity and lower potency than estrogens. However, they can stimulate the synthesis of sex hormone-binding globulin (SHBG) (Setchell and Cassidy 1999). This characteristic of isoflavones accounted for the structural similarities with endogenous estrogens and their mechanism of action. In a 3month study in aging female rats, soy isoflavone fed rats showed improved bone formation rate compared to rats fed on casein rich diet (Blum et al. 2003). Soy isoflavones have an affinity for estrogen receptors and can exert beneficial outcomes as expected during estrogen therapy on menopausal symptoms (Oseni et al. 2008; Lecomte et al. 2017). Besides, due to deficient expression of β-ERs in tissues having a higher risk for estrogen-dependent carcinoma, an oncological safety is anticipated with long-term use. However, findings on the matter are still deficient (De Franciscis et al. 2017).

Studies demonstrating soybean biological effects have either used soya supplements or extracts as a source to understand its bioactivity. Nevertheless, the extraction method may change or modify the soybean proteins and affect their biologic activity (Kerstetter et al. 2011). It has been accepted that Soybean proteins work in synergy with calcium to improve calcium retention and bone metabolism (Scheiber et al. 2001). Soybean milk is derived from the water extract of soybeans and has been traditionally prepared by crushing soaked soybeans with water. Soybean milk contains a balanced nutrients mixture, identical to cow’s milk; however, it is devoid of cholesterol, lactose, and gluten and, additionally, rich in favorable phytochemical compounds associated with health. Soymilk has been demonstrated to positively affect BMD and bone strength by enhancing intestinal absorption of calcium (Jeewanthi et al. 2015). Though the effect of isoflavones from soybeans has been well recognized, the impact of isoflavone-enriched soy milk powder (I-WSM) on the bone differentiation process is still not known. Thus, this study was designed to testify any effect of I-WSM on inducing osteogenic properties at cellular and molecular levels.

Materials and methods

Preparation of I-WSM

I-WSM was synthesized as described previously in our study (Kim et al. 2018). In brief, water rinsed whole soybeans were soaked (soybeans: water ratio of 1:9) for about 7h. After that, blender (K&S Co., LTD., Whasung, Korea) was used to grind soaked soybeans. The slurry so obtained was boiled at a temperature of 90°C for 1h. It was then cooled to 55°C. To hydrolyze carbohydrate, 2% (w/w) termamyl (Novozymes, Denmark) was supplemented to the slurry, and it was incubated at 55°C for 5h. After that, soymilk was obtained from the slurry by centrifugation (3500×g for 20min) to separate soymilk cake residues. To hydrolyze protein in soymilk, 1% (w/w) alcalase (Novozymes) was added and incubated at 55°C for 5h. It was followed by the addition of 1% (w/w) flavourzyme (Novozymes) and incubating at 55°C for 5h. To inactivate added enzymes, soymilk was boiled at 100°C for 30min. Finally, soymilk was freeze-dried with vacuum freeze-dryer (Operon, Kimpo, Korea) and finely grounded to less than 75μm particle size for experimental use. The isoflavone content of I-WSM was analyzed by using HPLC (Agilent, CA, USA). The total isoflavone concentration was 1660μg/g of I-WSM, which was about 8.8 times higher than the isoflavone content of 187.8μg/g of conventional whole soy milk powder (Kim et al. 2018).

Cell culture

Osteoblastic murine cell line, MC3T3-E1 (ATCC, CRL-2593) were grown in specific complete minimum essential medium (α-MEM; Invitrogen, Carlsbad, CA) with 10% fetal bovine serum (FBS) (Lonza, Walkersville, USA), contained 100 U/ml penicillin, and 100 U/ml streptomycin (Lonza, Basel, Switzerland) in the incubator at 37°C maintaining a humidified atmosphere of 5% CO₂.

MTT assay

MTT assay was done for the assessment of cell viability of MC3T3-E1 cells by using 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide (MTT). Cells were seeded in 96-well plates at an initial density of 2 × 10⁴ cells per well. Then, MTT reagent was added in to well to stain the cells and incubated the plate at 37°C for 3h in incubator. The overlying medium was removed carefully and the remaining insoluble formazan crystal of purple color was dissolved with dimethyl sulfoxide (DMSO). Optical density was analyzed through a 96 well plate microplate reader (SynergyTM HT, Bio-Tek Instruments, Inc.) at 570nm wavelength.

Lactate dehydrogenase (LDH) activity assay

LDH activity assay was carried out with a cytotoxicity detection kit (Roche, Mannheim, Germany) as per manufacturer’s instructions. In brief, 10μl cell culture media from an experimental sample and 40μl of PBS were added to a new 96-well plate. Afterward, 50μl of LDH reagent provided in the kit was introduced to each well. Finally, after 45min incubation, the enzymatic reaction was stopped in each well by adding a stop solution (50µl). Absorbance was measured at 492nm wavelength. For positive control for cell death, cell lysate of total cells was used.

Alkaline phosphatase (ALP) activity assay

To assess the ALP activity, MC3T3-E1 cells were seeded for the experiment at a density of 6 × 10⁴ cells/well in 48-well plates. I-WSM was treated to cells in specific complete media (α-MEM). Following 48h of treatment, ice-cold PBS was used to rinse the cells. Subsequently, cell lysis was done by adding 90µl/well of RIPA buffer. 20µl from the cell lysate was mixed with 100µl of CSPD substrate (ALP substrate) (Roche) for 30min. The luminescence reading was evaluated by a luminometer (Glomax, Promega, Sunnyvale, CA, USA). Protein estimation assay was performed with total cell lysate by using a protein assay kit (Bio-Rad, Hercules, CA) to normalize protein concentration.

RNA isolation and real-time RT-PCR

By following the manufacturer’s manuals, total RNA was harvested with Trizol reagent (Invitrogen, Carlsbad, CA, USA) to lyse the cells. The ratio was evaluated to examine the purity of collected RNA at 260/280 absorbance. 2µg of total RNA was consumed for the synthesis of cDNA first strand using SuperScript II reverse transcriptase (Invitrogen). One-tenth of the cDNA was taken as a template for each PCR mixture containing EXPRESS SYBR green qPCR Supermix (BioPrince, Seoul, Korea). Real-time PCR was performed using a Rotor-Gene Q (Qiagen, Hilden, Germany). The amplification reaction was run to complete 40-cycle at 95°C for 20s, 60°C for 20s, and at 72°C for 25s. Relative expression of target genes was standardized to housekeeping gene GAPDH and was analyzed using 2^−ΔΔCT method. The utilized PCR primers pair sequences are listed in Table 1.

Table 1.

Sequences of primers used in this study

Target	Forward primer (5′– > 3′)	Reverse primer (3′– > 5′)
Osterix	AGCGACCACTTGAGCAAACAT	GCGGCTGATTGGCTTCTTCT
Runx2	CGGCCCTCCCTGAACTCT	TGCCTGCCTGGGATCTGTA
GAPDH	TCAACAGCAACTCCCACTCTTCCA	ACCCTGTTGCTGTAGCCGTATTCA

Open in a new tab

ELISA

The osteoblast-secreted osteocalcin level in the cell culture media was measured using the osteocalcin ELISA Kit (Takara Bio Inc., Kusatus, Japan) as per the manufacturer’s instructions. 100μl of provided standards and collected culture supernatant were added in the coated 96 well plates supplied in a kit. The dish was kept for 1h incubation at 37°C. After 1h, the wells were washed three times with washing buffer. Next, HRP conjugated secondary antibody was added to each well. Following the incubation at 37°C for 30min, the wells were rewashed about five times. Subsequently, the TMB solution was added, and the samples were incubated in the dark at room temperature for 20min. Finally, a stop solution was added to stop the reaction, and the optical density was measured at a wavelength of 450nm within 15min in a microplate reader.

Assessment of mineralization

To determine calcium content in osteoblasts, Alizarin Red S, an anthraquinonoid derivative dye, was used. Cells at density 2 × 10⁴ cells/well were grown in 24 wells culture plate. At various concentrations of I-WSM, cells were treated for 7 and 14days, and the medium was changed every 3rd day. After 7 and 14days, cells were gently rinsed with PBS, and fixation was done with 4% paraformaldehyde for 2h. Next, cells were soaked with 40mM Alizarin Red-S (pH 4.5) for overnight. After washing with PBS several times, calcified nodules were photographed using a light microscope. 100mM cetylpyridinium chloride solution was added for 1h in each well for quantification. To release and solubilize calcium-bound alizarin red into solution, the plate was incubated for 1h. Absorbance was observed at 570nm by a microplate reader.

Assessment of collagen deposition

Collagen deposition was measured using Sirius Red staining following slight modification (Tullberg-Reinert and Jundt 1999). Sirius red is an anionic sulfonatedazo dye that binds selectively and intensely to collagen fibrils. Sirius red dye solution having pH 3.5 was prepared in saturated aqueous picric acid (1.3% in H₂O). For the experiment, treated MC3T3-E1 cells with I-WSM were washed with PBS. Cells were fixed by adding 1ml of Bouin’s fluid for 1h. After washing the cells with PBS several times, Sirius Red dye solution was added for 2h to stain the cells. After rinsing stained cells with PBS, photographs were taken by a light microscope (LEICA DM 4000B, Wetzlar, Germany). For quantitative analysis, stained cell layers were extensively soaked with 0.01N HCl to eliminate all non-bounded dye. After that, staining was dissolved in 0.2ml 0.1N NaOH at a microplate shaker for 30min at room temperature. Next, absorbance was evaluated using a spectrometer at a wavelength of 562nm against 0.1N NaOH serve as a blank.

Luciferase activity

MC3T3-E1 cells were seeded and prepared in a 48-well plate at an initial density of 5 × 10⁴ cells/well for luciferase assay. As per the manufacturer’s manuals, Genefectine (Genetrone Biotech Co., Jeonju, Korea) transfection reagent specific for MC3T3-E1 was used to transfect the cells. Following 24h treatment of I-WSM, cells were lysed with 100µl of passive lysis buffer (1x) supplied in the Dual-Luciferase Reporter Assay kit (Promega, Madison, WI, USA). Luciferase activity of samples was measured by a single tube Glomax luminometer (Promega) with an integration time of 1s.

Statistical analysis

Data are represented as the mean ± standard deviation of three independent experiments, and the statistical significance was assessed using a paired Student’s two-tailed t-test (a = 0.05) or study of variance. Statistical analyses and graphs were produced using GraphPad Prism 5.0 (GraphPad Software, San Diego, CA, USA). Significance graphically stated as ^*P < 0.05; ^**P < 0.01; ^***P < 0.001, unless otherwise indicated.

Results

Effect of the I-WSM on the differentiation of osteoblasts

Initially, whether I-WSM can affect the osteoblasts differentiation process was assessed by the ALP activity. ALP is produced and is secreted by osteoblasts and is associated with the early differentiation of osteoblasts. Before the ALP assay, any proliferative or cytotoxic effect of I-WSM (0.5–200µg/ml) on MC3T3-E1 cells was determined by MTT assay and LDH assays (Fig. S1A and B). Results showed no significant effect on cell viability and toxicity for the tested doses of I-WSM on MC3T3-E1 cells. For ALP activity, MC3T3-E1 cells were seeded in 48 well plates and treated with I-WSM at a concentration of 1–100µg/ml for 48h. It was observed that stimulation by I-WSM induced significant ALP activity in osteoblasts (Fig.1a).

Fig. 1.

Open in a new tab

To further investigate the effect of I-WSM on the osteoblasts differentiation process, the I-WSM was treated, and terminal differentiation markers like collagen synthesis and mineralization were analyzed. Mineralization and collagen synthesis were analyzed qualitatively and quantitatively by Alizarin Red S staining and Sirius Red staining, respectively (Fig.1b–d). The formation of the mineralized matrix, along with the synthesis of collagen by osteoblasts, is a sign of osteoblast differentiation. In comparison to control, high calcium deposition, as well as increased collagen synthesis, were observed in I-WSM (1–100µg/ml) stimulated osteoblasts. Additionally, Alizarin Red S and Sirius Red quantifications exhibited an increase in matrix mineralization and collagen synthesis in a dose-dependent manner after 14days.

Effects of I-WSM in the regulation of Osterix and Runx2 gene expression in osteoblasts

To identify whether I-WSM has any stimulatory effect on the expression of osteogenic transcriptional factors such as Osterix and (Runt-related transcription factor 2) Runx2, osteoblast cells were treated with I-WSM (1–100μg/ml) and the mRNA expression levels were measured by real-time RT-PCR. After treatment with I-WSM at a concentration of 1μg/ml, the mRNA expression levels of Osterix and Runx2 were significantly upregulated compared with control. However, expressions of Osterix and Runx2 had no further significant increase at a higher concentration of 100μg/ml of I-WSM (Fig.2a, b).

Fig. 2.

Open in a new tab

For the bone matrix, Osteoblasts synthesize osteocalcin as a major non-collagenous protein. A part of the osteocalcin is integrated into the bone matrix, while a few amounts of it is delivered to the circulatory system (Moser and van der Eerden 2018). It is well known that the circulating level of osteocalcin can reflect the rate of bone formation and is also associated with the changes in bone turnover in the metabolic bone. For this, MC3T3-E1 cells were cultured with or without treatment of I-WSM at a concentration of 1–100μg/ml. Cells were treated every 2days until 14days with a new culture medium to maintain optimal growth conditions. Supernatants were harvested after completing 2, 7, and 14days for ELISA. Results obtained from ELISA showed that on day 2 (early time point), the amount of osteocalcin released in media was significantly higher in the wells with the treatment of I-WSM (1–100μg/ml) (Fig.2c), which even was followed at 7 and 14days (data not shown).

Effect of I-WSM on the estrogen signaling pathway

MC3T3-E1 cells express both estrogen receptors (ER α and ER β) (Matsumoto et al. 2013). To assess any effect of I-WSM on the estrogen signaling pathway, its ability to induce any effect on 3X ERE TATA-luc reporter plasmid (Reporter plasmid with three estrogen-responsive elements tagged upstream of a luciferase reporter) was determined. 3X ERE TATA-luc was transiently transfected to MC3T3-E1 cells, and I-WSM or 17β-estradiol (a known agonist) were treated for 24h. I-WSM and 17β-estradiol were able to induce luciferase activity in MC3T3-E1 cells (Fig.3a). To evaluate any participation of the activation of estrogen signaling in increased ALP activity by I-WSM, pharmacological inhibitor (ICI 182,780) of both estrogen receptors was utilized. As depicted in Fig.3b, ICI 182,780 (10µM) pretreated MC3T3-E1 cells were incubated with I-WSM (10µg) and 17β-estradiol along with culture medium for 48h. The pretreatment of ICI 182,780 completely abrogated the I-WSM induced luciferase activity, indicating the role of I-WSM in ALP activity induction through the estrogen signaling pathway.

Fig. 3.

Open in a new tab

Discussion

Soymilk powder contains isoflavones that are commonly referred to as phytoestrogens. Recently, the intake of soy isoflavones has been found associated with an increase in BMD of Asian women (Mei et al. 2001; Sebastian 2005). It also has been discovered to impede the loss of bone in ovariectomized rats (Santos et al. 2014; Chang et al. 2013). The study clearly showed that the intake of soy isoflavones could increase the cortical and trabecular bone health in ovariectomized rats (Santos et al. 2014). In the present study, we have explored the potential of I-WSM in affecting the differentiation ability of osteoblasts. Treatment of various doses of I-WSM did not affect any cellular proliferation and cytotoxicity of MC3T3-E1 cells (Fig. S1). During the early differentiation process of osteoblasts maturation, an increase in the expression of ALP is observed. While the late differentiation process of osteoblasts is accompanied by an increase in collagen synthesis and mineralization (Rutkovskiy et al. 2016). I-WSM was able to stimulate ALP activity in MC3T3-E1 cells (Fig.1a). Moreover, an increase in late differentiation markers for osteoblasts like collagen synthesis and mineralization was observed after I-WSM treatment (Fig.1, c). Our results are in line with that of Yu et al., where they have demonstrated that soy isoflavones can stimulate ALP activity after treatment of 7 and 14days, while mineralized nodule formation and the calcium content of mineralized nodules in rat primary osteoblasts were increased after 10days of treatment (Yu et al. 2015). However, in our results, we have shown that I-WSM is able to induce significant ALP activity in osteoprogenitors even at an early time point (48h).

The molecular switch that is required and is necessary for the final fate of osteoprogenitors to osteoblast lineage is the transcription factor Runx2/core binding factor alpha 1 (Cbfa1) (Rutkovskiy et al. 2016). Runx2 is responsible for the exit of pre-osteoblasts from the cell cycle and regulates initiation of the differentiation process until the late maturation of osteoblasts (Qi et al. 2003). Runx2 affects the downstream osteogenic genes along with cofactors like Osterix. Studies have revealed that while Runx2 is necessary for the commitment of mesenchymal stem cells toward osteoblast lineage, Osterix is required for accomplishing the process of osteoblast differentiation (Sinha and Zhou 2013). Activation of Runx2, along with Osterix, is shown to regulate the expression of extracellular protein like osteocalcin during differentiation of osteoblasts (Ducy 2000). Osteocalcin is an osteoblast-specific gene that is expressed in a considerable amount by completely differentiated osteoblasts. Besides, osteocalcin participates in organic scaffold formation and promotes the deposition of mineral substance on the extracellular matrix. I-WSM treatment increased the mRNA expression of Runx2 and Osterix in osteoprogenitors. Moreover, after 2days of I-WSM treatment, a significant release of osteocalcin was observed in the culture medium of MC3T3-E1 cells. Even after 14days of I-WSM treatment, a considerable amount of osteocalcin was detected from the osteoprogenitors (Data not shown). In order to initiate the differentiation in osteoblasts activation of transcriptional factors, Runx2 and Osterix are required (Komori 2011). I-WSM stimulated Runx-2 and Osterix expression at a low dose of 1 and 10µg/ml for 24h of treatment while the increase in different osteogenic markers required a higher dose (100µg/ml) for 48h treatment or more for their induction. It appears that early stimulation with a low dose (1 and 10µg/ml) of I-WSM is optimal for the induction of Runx-2 and Osterix; hence no further significant increase was observed after a higher dose of treatment. Elevated mRNA expression of Runx2 and Osterix by I-WSM might contribute to an increase in osteogenic differentiation markers of osteoblasts (ALP activity, collagen synthesis, the release of osteocalcin, and process of mineralization). Runx2 and Osterix work in tandem with the WNT signaling pathway. Several reports indicated that stimulated protein expression of Runx-2 causes activation of the osteocalcin gene via activation of the WNT signaling pathway (Kahler and Westendorf 2003).

Non-steroidal in nature, isoflavones demonstrate estrogen-like characteristics and have the ability to bind estrogen receptors (ER α and ER β)(Tempfer et al. 2007). Binding to estrogen receptors allows them to exert biological effects similar to estrogens. Estrogens are required to maintain bone metabolism as well as bone mineral density. Estrogen achieves these effects by several mechanisms; for example, it can repress pro-osteoblastic cytokine (IL-1, IL-6, IL-7, and TNF) release from T cells and osteoblasts. Moreover, it has been reported to induce apoptosis in bone-resorbing osteoclasts and has an anti-apoptotic effect on osteoblasts (Khalid and Krum 2016). Hence, the ability of isoflavones to mimic the biological effects of estrogen without any side effects makes them a perfect candidate as an alternative for bone health maintenance. Hence, we verified any effect of I-WSM on the estrogen signaling pathway. Our result confirmed the stimulatory effect of I-WSM on estrogen signaling (Fig.3). Moreover, pharmacological inhibition of both the estrogen receptors inhibited I-WSM induced ALP activity in osteoprogenitors, validating the involvement of estrogen signaling. It will be interesting to investigate whether the estrogen signaling pathway works independently or have any cross-talk with other signaling pathways for exerting this osteogenic effect under the influence of I-WSM.

Conclusion

I-WSM has the ability to exert osteogenic activity both at the initial and terminal stages of differentiation of osteoblasts. I-WSM achieves this property by activating transcriptional factors like Runx2 and Osterix, which then causes an increase in the extracellular matrix protein-like osteocalcin, required for the formation of scaffold for bone mineralization. I-WSM requires an estrogen signaling pathway to induce its osteogenic activity. After menopause, osteoporosis and bone fracture in females are the consequence of deficient estrogen cascade responsible for maintaining bone homeostasis. I-WSM unique ability to activate the estrogen signaling pathway might have the potential to enhance osteogenic function and treat osteoporosis. Therefore, our results highlight the cellular and molecular mediated osteogenic effect of I-WSM, which will help to understand its mechanism of action and project it as a remedy for a bone-related disease like osteoporosis.

Electronic supplementary material

Below is the link to the electronic supplementary material.

13197_2020_4572_MOESM1_ESM.tiff^{(144.7KB, tiff)}

Figure S1A. Viability was evaluated by performing MTT assay after 48 h of IWSMtreatment with various dosage (0.5–200 μg/ml). Data are means ± SEM (n = 3). **P < 0.01 (TIFF 144 kb)

13197_2020_4572_MOESM2_ESM.tiff^{(154.8KB, tiff)}

Figure S1B. LDH activity was evaluated after 48 h of I-WSM treatment with various dosages (0.5–200 μg/ml). Data are means ± SEM (n = 3). **P < 0.01 (TIFF 154 kb)

Acknowledgements

This research work was supported by the Ministry of Trade, Industry, and Energy (MOTIE), Korea Institute for Advancement of Technology (KIAT) through the Research and Promotion Regional Specialized Industry (R0005131) and by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2016R1D1A1B03931318).

Compliance with ethical standards

Conflict of interest

The author(s) declare that they have no conflict.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Eun Ji Kim, Email: myej4@hallym.ac.kr.

Ju-Suk Nam, Email: jsnam88@empal.com.

References

Ahn H, Park YK. Soy isoflavone supplementation improves longitudinal bone growth and bone quality in growing female rats. Nutrition. 2017;37:68–73. doi: 10.1016/j.nut.2016.12.008. [DOI] [PubMed] [Google Scholar]
Blum SC, Heaton SN, Bowman BM, Hegsted M, Miller SC. Dietary soy protein maintains some indices of bone mineral density and bone formation in aged ovariectomized rats. J Nutr. 2003;133(5):1244–1249. doi: 10.1093/jn/133.5.1244. [DOI] [PubMed] [Google Scholar]
Chang KL, Hu YC, Hsieh BS, Cheng HL, Hsu HW, Huang LW, Su SJ. Combined effect of soy isoflavones and vitamin D3 on bone loss in ovariectomized rats. Nutrition. 2013;29(1):250–257. doi: 10.1016/j.nut.2012.03.009. [DOI] [PubMed] [Google Scholar]
De Franciscis P, Grauso F, Luisi A, Schettino MT, Torella M, Colacurci N. Adding agnus castus and magnolia to soy isoflavones relieves sleep disturbances besides postmenopausal vasomotor symptoms-long term safety and effectiveness. Nutrients. 2017 doi: 10.3390/nu9020129. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ducy P. Cbfa1: a molecular switch in osteoblast biology. Dev Dynam. 2000;219(4):461–471. doi: 10.1002/1097-0177(2000)9999:9999<::AID-DVDY1074>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
Friedman M, Brandon DL. Nutritional and health benefits of soy proteins. J Agric Food Chem. 2001;49(3):1069–1086. doi: 10.1021/jf0009246. [DOI] [PubMed] [Google Scholar]
Hu C, Wong WT, Wu R, Lai WF. Biochemistry and use of soybean isoflavones in functional food development. Crit Rev Food Sci Nutr. 2019 doi: 10.1080/10408398.2019.1630598. [DOI] [PubMed] [Google Scholar]
Jeewanthi RK, Lee NK, Lee KA, Yoon YC, Paik HD. Comparative analysis of improved soy-mozzarella cheeses made of ultrafiltrated and partly skimmed soy blends with other mozzarella types. J Food Sci Technol. 2015;52(8):5172–5179. doi: 10.1007/s13197-014-1542-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kahler RA, Westendorf JJ. Lymphoid enhancer factor-1 and beta-catenin inhibit Runx2-dependent transcriptional activation of the osteocalcin promoter. J Biol Chem. 2003;278(14):11937–11944. doi: 10.1074/jbc.M211443200. [DOI] [PubMed] [Google Scholar]
Kerstetter JE, Kenny AM, Insogna KL. Dietary protein and skeletal health: a review of recent human research. Curr Opin Lipidol. 2011;22(1):16–20. doi: 10.1097/MOL.0b013e3283419441. [DOI] [PMC free article] [PubMed] [Google Scholar]
Khalid AB, Krum SA. Estrogen receptors α and β in bone. Bone. 2016;87:130–135. doi: 10.1016/j.bone.2016.03.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kim SM, Lee HS, Jung JI, Lim SM, Lim JH, Ha WH, Jeon CL, Lee JY, Kim EJ. Effect of isoflavone-enriched whole soy milk powder supplementation on bone metabolism in ovariectomized mice. Nutr Res Practice. 2018;12(4):275–282. doi: 10.4162/nrp.2018.12.4.275. [DOI] [PMC free article] [PubMed] [Google Scholar]
Komori T. Signaling networks in RUNX2-dependent bone development. J Cell Biochem. 2011;112(3):750–755. doi: 10.1002/jcb.22994. [DOI] [PubMed] [Google Scholar]
Lecomte S, Demay F, Ferriere F, Pakdel F. Phytochemicals targeting estrogen receptors: beneficial rather than adverse effects? Int J Mol Sci. 2017 doi: 10.3390/ijms18071381. [DOI] [PMC free article] [PubMed] [Google Scholar]
Li Y, Zhang H. Soybean isoflavones ameliorate ischemic cardiomyopathy by activating Nrf2-mediated antioxidant responses. Food Funct. 2017;8(8):2935–2944. doi: 10.1039/c7fo00342k. [DOI] [PubMed] [Google Scholar]
Liang HD, Yu F, Lv P, Zhao ZN, Tong ZH. Role of Sost in Wnt signal pathway in osteoporosis rats and regulating effect of soybean isoflavones on Wnt signal pathway. Mol Biol Rep. 2014;41(7):4447–4454. doi: 10.1007/s11033-014-3315-2. [DOI] [PubMed] [Google Scholar]
Matsumoto Y, Otsuka F, Takano-Narazaki M, Katsuyama T, Nakamura E, Tsukamoto N, Inagaki K, Sada KE, Makino H. Estrogen facilitates osteoblast differentiation by upregulating bone morphogenetic protein-4 signaling. Steroids. 2013;78(5):513–520. doi: 10.1016/j.steroids.2013.02.011. [DOI] [PubMed] [Google Scholar]
Mei J, Yeung SS, Kung AW. High dietary phytoestrogen intake is associated with higher bone mineral density in postmenopausal but not premenopausal women. J Clin Endocrinol Metab. 2001;86(11):5217–5221. doi: 10.1210/jcem.86.11.8040. [DOI] [PubMed] [Google Scholar]
Moser SC, van der Eerden BCJ. Osteocalcin-a versatile bone-derived hormone. Front Endocrinol. 2018;9:794. doi: 10.3389/fendo.2018.00794. [DOI] [PMC free article] [PubMed] [Google Scholar]
Nguyen LT, Maidar O, Sharma AR, Sharma G, Kim HC, Park S, Lee SS, Nam JS. Enhanced healing process of fracture by treatment of Kaempferol. Biomed Res-India. 2016;27(1):138–144. [Google Scholar]
Oseni T, Patel R, Pyle J, Jordan VC. Selective estrogen receptor modulators and phytoestrogens. Planta Med. 2008;74(13):1656–1665. doi: 10.1055/s-0028-1088304. [DOI] [PMC free article] [PubMed] [Google Scholar]
Qi H, Aguiar DJ, Williams SM, La Pean A, Pan W, Verfaillie CM. Identification of genes responsible for osteoblast differentiation from human mesodermal progenitor cells. Proc Natl Acad Sci USA. 2003;100(6):3305–3310. doi: 10.1073/pnas.0532693100. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rutkovskiy A, Stenslokken KO, Vaage IJ. Osteoblast differentiation at a glance. Med Sci Monit Basic Res. 2016;22:95–106. doi: 10.12659/MSMBR.901142. [DOI] [PMC free article] [PubMed] [Google Scholar]
Santos MA, Florencio-Silva R, Medeiros VP, Nader HB, Nonaka KO, Sasso GR, Simoes MJ, Reginato RD. Effects of different doses of soy isoflavones on bone tissue of ovariectomized rats. Climacteric. 2014;17(4):393–401. doi: 10.3109/13697137.2013.830606. [DOI] [PubMed] [Google Scholar]
Scheiber MD, Liu JH, Subbiah MT, Rebar RW, Setchell KD. Dietary inclusion of whole soy foods results in significant reductions in clinical risk factors for osteoporosis and cardiovascular disease in normal postmenopausal women. Menopause. 2001;8(5):384–392. doi: 10.1097/00042192-200109000-00015. [DOI] [PubMed] [Google Scholar]
Sebastian A. Isoflavones, protein, and bone. Am J Clin Nutr. 2005;81(4):733–735. doi: 10.1093/ajcn/81.4.733. [DOI] [PubMed] [Google Scholar]
Setchell KD, Cassidy A. Dietary isoflavones: biological effects and relevance to human health. J Nutr. 1999;129(3):758S–767S. doi: 10.1093/jn/129.3.758S. [DOI] [PubMed] [Google Scholar]
Sharma AR, Nam JS. Kaempferol stimulates WNT/β-catenin signaling pathway to induce differentiation of osteoblasts. J Nutr Biochem. 2019;74:108228. doi: 10.1016/j.jnutbio.2019.108228. [DOI] [PubMed] [Google Scholar]
Sinha KM, Zhou X. Genetic and molecular control of Osterix in skeletal formation. J Cell Biochem. 2013;114(5):975–984. doi: 10.1002/jcb.24439. [DOI] [PMC free article] [PubMed] [Google Scholar]
Tempfer CB, Bentz EK, Leodolter S, Tscherne G, Reuss F, Cross HS, Huber JC. Phytoestrogens in clinical practice: a review of the literature. Fertil Steril. 2007;87(6):1243–1249. doi: 10.1016/j.fertnstert.2007.01.120. [DOI] [PubMed] [Google Scholar]
Tullberg-Reinert H, Jundt G. In situ measurement of collagen synthesis by human bone cells with a sirius red-based colorimetric microassay: effects of transforming growth factor beta2 and ascorbic acid 2-phosphate. Histochem Cell Biol. 1999;112(4):271–276. doi: 10.1007/s004180050447. [DOI] [PubMed] [Google Scholar]
Xu JL, Shin JS, Park SK, Kang S, Jeong SC, Moon JK, Choi Y. Differences in the metabolic profiles and antioxidant activities of wild and cultivated black soybeans evaluated by correlation analysis. Food Res Int. 2017;100(Pt 2):166–174. doi: 10.1016/j.foodres.2017.08.026. [DOI] [PubMed] [Google Scholar]
Yu F, Liu Z, Tong Z, Zhao Z, Liang H. Soybean isoflavone treatment induces osteoblast differentiation and proliferation by regulating analysis of Wnt/β-catenin pathway. Gene. 2015;573(2):273–277. doi: 10.1016/j.gene.2015.07.054. [DOI] [PubMed] [Google Scholar]
Zaheer K, Humayoun Akhtar M. An updated review of dietary isoflavones: nutrition, processing, bioavailability and impacts on human health. Crit Rev Food Sci Nutr. 2017;57(6):1280–1293. doi: 10.1080/10408398.2014.989958. [DOI] [PubMed] [Google Scholar]
Zheng X, Lee SK, Chun OK. Soy isoflavones and osteoporotic bone loss: a review with an emphasis on modulation of bone remodeling. J Med Food. 2016;19(1):1–14. doi: 10.1089/jmf.2015.0045. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13197_2020_4572_MOESM1_ESM.tiff^{(144.7KB, tiff)}

Figure S1A. Viability was evaluated by performing MTT assay after 48 h of IWSMtreatment with various dosage (0.5–200 μg/ml). Data are means ± SEM (n = 3). **P < 0.01 (TIFF 144 kb)

13197_2020_4572_MOESM2_ESM.tiff^{(154.8KB, tiff)}

Figure S1B. LDH activity was evaluated after 48 h of I-WSM treatment with various dosages (0.5–200 μg/ml). Data are means ± SEM (n = 3). **P < 0.01 (TIFF 154 kb)